View Feed
group-icon
Coffee Room
Discuss anything here - everything that you wish to discuss with fellow engineers.
12914 Members
Join this group to post and comment.
Nikita Kabra
Nikita Kabra • Oct 14, 2015

Project discussion : secure data transmission by using DNA triplet code

Hi,
I am final year student from computer engineering. My project topic is secure data transmission by using DNA triplet code. In which i am using the bi-serial algorithm.
There is a concept of PCR amplification and the primers. I am not able to understand how to make primers from DNA sequence.
I am referring IEEE papers for it.
If anyone has any idea regarding PCR amplification and primers, please reply.
Kaustubh Katdare
Kaustubh Katdare • Oct 14, 2015
@Nikita Kabra - You could start by asking specific questions or doubts about the parts that you do not understand. It will make it easier for others to answer.
Nikita Kabra
Nikita Kabra • Oct 14, 2015
Consider an example:

TEXT:
CRYPTO

HEXA VALUE:
63727970746F

BINARY VALUE:
01100011011100010011110011011100000111010001101111

For converting Binary to DNA digital code following sequences are used
00:A
01:T
10:G
11:C

DNA DIGITAL CODING:
TGACTCAGTCGTTCAATCTATGCC

KEY VALUE: 70746F

The main question is,
How this following primers are formed by using the above DNA Digital coding??

PRIMER 1: A
PRIMER 2: T


FINAL AMPLIFIED CIPHER TEXT:
TTATGTATCTATTTATCTATATATGTATTTATCTATGT
ATTTATTTATCTATATATATATTTATCTATTTATATAT
TTATGTATCTATCTAT

and also how to perform amplification?
Please reply.

Share this content on your social channels -