Nikita Kabra
Nikita Kabra
Branch Unspecified
14 Oct 2015

Project discussion : secure data transmission by using DNA triplet code

Hi,
I am final year student from computer engineering. My project topic is secure data transmission by using DNA triplet code. In which i am using the bi-serial algorithm.
There is a concept of PCR amplification and the primers. I am not able to understand how to make primers from DNA sequence.
I am referring IEEE papers for it.
If anyone has any idea regarding PCR amplification and primers, please reply.
14 Oct 2015
@Nikita Kabra - You could start by asking specific questions or doubts about the parts that you do not understand. It will make it easier for others to answer.
Nikita Kabra

Nikita Kabra

Branch Unspecified
14 Oct 2015
Consider an example:

TEXT:
CRYPTO

HEXA VALUE:
63727970746F

BINARY VALUE:
01100011011100010011110011011100000111010001101111

For converting Binary to DNA digital code following sequences are used
00:A
01:T
10:G
11:C

DNA DIGITAL CODING:
TGACTCAGTCGTTCAATCTATGCC

KEY VALUE: 70746F

The main question is,
How this following primers are formed by using the above DNA Digital coding??

PRIMER 1: A
PRIMER 2: T


FINAL AMPLIFIED CIPHER TEXT:
TTATGTATCTATTTATCTATATATGTATTTATCTATGT
ATTTATTTATCTATATATATATTTATCTATTTATATAT
TTATGTATCTATCTAT

and also how to perform amplification?
Please reply.

Share this content on your social channels -

Only logged in users can reply.